BIGNASim database structure and analysis portal for nucleic acids simulation data

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_2lpw 2LPW Dna G-loop parmBSC1 TIP3P DNA Single Stranded Naked ParmBSC1 TIP3P Electroneutral G-Loop 5,000 AAGGGTGGGTGTAAGTGTGGGTGGGT
NAFlex_1anr 1ANR Rna A parmBSC0 TIP3P RNA-A Single Stranded HIV-1 TAR Naked ParmBSC0 TIP3P Electroneutral internal-loops hairpin-loops 4,939 GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
NAFlex_D05M 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 3,000 CGCGAATTCGCG
NAFlex_DTipDang015M 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 2,000 CGCGAATTCGCG
NAFlex_ProtDNA_1a66 1A66 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CAATTTTCCTCG
NAFlex_ProtDNA_1c7u 1C7U Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTCGGCTATTAATAGCCGAG
NAFlex_ProtDNA_1cdw 1CDW Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTGCTATAAAAGGCTG
NAFlex_ProtDNA_1h9t 1H9T Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CATCTGGTACGACCAGATC
NAFlex_ProtDNA_1hlv 1HLV Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AATCCCGTTTCCAACGAAGGC
NAFlex_ProtDNA_1iv6 1IV6 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CCCTAACCCTAAC
NAFlex_ProtDNA_1j46 1J46 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CCTGCACAAACACC
NAFlex_ProtDNA_1j5n 1J5N Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTGAACAATCACCCC
NAFlex_ProtDNA_1je8 1JE8 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGTACCCATTAATGGGTACG
NAFlex_ProtDNA_1k6o 1K6O Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CACAGGATGTCCATATTAGGACA
NAFlex_ProtDNA_1qn5 1QN5 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 TGCCCTCTTATAGC
NAFlex_ProtDNA_1r4i 1R4I Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CCAGAACATCAAGAACAG
NAFlex_ProtDNA_1vtn 1VTN Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GACTAAGTCAACC
NAFlex_ProtDNA_1yo5 1YO5 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 ACACATCCTGCTA
NAFlex_ProtDNA_1zgw 1ZGW Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GCAAATTAAAGCGCAAGA
NAFlex_ProtDNA_2hdc 2HDC Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GCTTAAAATAACAATAC
NAFlex_ProtDNA_2kdz 2KDZ Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AAGATAACGATATTTA
NAFlex_ProtDNA_2l1g 2L1G Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGCTGCCCACACAAGC
NAFlex_ProtDNA_2lt7 2LT7 Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGTTATTGGCAGGAAGCAC
NAFlex_ProtDNA_2or1 2OR1 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AAGTACAAACTTTCTTGTAT
NAFlex_ProtDNA_2stw 2STW Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 TCGAACTTCCGGCTCGA
NAFlex_ProtDNA_3f27 3F27 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CCAGGACAATAGAGAC
NAFlex_ProtDNA_3jxc 3JXC Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CATTTAAGATATCTTAAATG
NAFlex_ProtDNA_3u2b 3U2B Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GTCTCTATTGTCCTGG
NAFlex_ProtDNA_4f6n 4F6N Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGTATAGACGCGGTGACAC
NAFlex_ProtDNA_4hqe 4HQE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AGTATAATTATTATACC
NAFlex_ProtDNA_4oi7 4OI7 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CACGTTCGTAGCATCGTTGCAG
NAFlex_ProtDNA_s1j5n 1J5N Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GGGGTGATTGTTCAG
NAFlex_ProtDNA_s2lef 2LEF Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CACCCTTTGAAGCTC
NAFlex_ProtDNA_1a0a 1A0A Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTAGTCCCACGTGTGAG
NAFlex_2l8f 2L8F Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral Internal-loops 1,750 GUGAAGCCCGU
NAFlex_BSC1-BSC0 1NAJ Dna B parmBSC0 TIP3P DNA-B Duplex Naked TIP3P Electroneutral ParmBSC0 1,500 CGCGAATTCGCG
NAFlex_BSC1-C36 1NAJ Dna B Charmm36 TIP3P DNA-B Duplex Naked Charmm36 TIP3P Electroneutral 1,500 CGCGAATTCGCGCGCGAATTCGCG
NAFlex_BSC1-Garcia 1NAJ Dna B ParmBSC0-CG TIP3P DNA-B Duplex Naked Cheng-Garcia TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL1 1NAJ Dna B ParmBSC0-OL1 TIP3P DNA-B Duplex Naked OL1 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL1-OL4 1NAJ Dna B ParmBSC0-OL1-OL4 TIP3P DNA-B Duplex Naked OL1+OL4 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL4 1NAJ Dna B ParmBSC0-OL4 TIP3P DNA-B Duplex Naked OL4 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_DDD_II 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,200 CGCGAATTCGCG
NAFlex_2oue 2OUE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral Flipout-bases Overhanging-bases Hammerhead Ribozyme Bulges 1,065 UCCCXGUCCACCG | CGGUGAGAAGGG | GGCAGAGAAACACACGA
NAFlex_hybrid NONE Rna A parmBSC0 TIP3P Hybrid-A Duplex Naked ParmBSC0 TIP3P Electroneutral 1,037 CTACACGG
NAFlex_2m18 2M18 Rna A parmBSC0 TIP3P RNA-A Quadruplex Naked ParmBSC0 TIP3P Electroneutral G-Quadruplex Tetraplex 1,036 GGGUUAGGGU | GGGUUAGGGU | GGGUUAGGGU | GGGUUAGGGU
NAFlex_GAGA_RNA 1Q9A Rna A parmBSC0 TIP3P RNA-A Single Stranded Naked ParmBSC0 TIP3P Electroneutral Sarcin-Ricin Hairpin loop Flipout-bases 1,022 CGCGAGAGCG
NAFlex_437d 437D Rna A parmBSC0 TIP3P RNA-A Single Stranded Naked ParmBSC0 TIP3P Electroneutral Pseudoknot Flipout-bases Overhanging-bases Loops 1,015 GGCGCGGCACCGUCCGCGGAACAAACGG
NAFlex_1d11 1D11 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral Ligand-intercalator 1,000 CGTACG
NAFlex_1dcw 1DCW Dna B parmBSC1 TIP3P DNA-B HollidayJunction Naked ParmBSC1 TIP3P Electroneutral 4way-junction inverted-repeat 1,000 CCGGTACCGG | CCGGTACCGG | CCGGTACCGG
NAFlex_1p71 1P71 Prot-Dna B parmBSC1 SPCE DNA-B Duplex Complex ParmBSC1 SPC/E AddedSalt Protein-nuc Flipout-bases 1,000 TGCTTATCAATTTGTTGCA
NAFlex_1p71B 1P71 Prot-Dna B parmBSC1 SPCE DNA-B Duplex Complex ParmBSC1 SPC/E AddedSalt 1,000 TGCAACAAATTGTTGCA
NAFlex_1pqt 1PQT Dna B parmBSC1 TIP3P DNA-B Single Stranded Naked ParmBSC1 TIP3P AddedSalt Hairpin 1,000 GCGAAGC
NAFlex_1tro 1TRO Prot-Dna B parmBSC1 SPCE DNA-B Duplex Complex ParmBSC1 SPC/E AddedSalt Prot-nuc Overhanging-bases 1,000 GTACTAGTTAACTAGTAC
NAFlex_2dgc 2DGC Prot-Dna B parmBSC1 SPCE DNA-B Duplex Complex ParmBSC1 SPC/E AddedSalt Protein-nuc 1,000 GGAGATGACGTCATCTCC
NAFlex_2jwv 2JWV Rna A parmBSC1 TIP3P RNA-A Single Stranded Hairpin-Loop Naked ParmBSC1 TIP3P AddedSalt 1,000 GAUACUUGAAACUGUAAGGUUGGCGUAUC
NAFlex_2lef 2LEF Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 CACCCTTTGAAGCTC
NAFlex_2y95 2Y95 Rna A parmBSC1 TIP3P RNA-A Single-Stranded Naked ParmBSC1 TIP3P AddedSalt Hairpin-loop 1,000 GGCGCAUCGGCGCC
NAFlex_32mer NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 ATGGATCCATAGACCAGAACATGATGTTCTCA
NAFlex_3jxc 3JXC Prot-Dna B parmBSC1 SPCE DNA-B Duplex Complex ParmBSC1 SPC/E AddedSalt Protein-nuc 1,000 CATTTAAGATATCTTAAATG
NAFlex_HTQ 1KF1 Dna G-loop parmBSC1 TIP3P DNA Single-Stranded G-Loop Naked ParmBSC1 TIP3P Electroneutral Telomer 1,000 AGGGTTAGGGTTAGGGTTAGGG
NAFlex_lks1 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 GCCTATAAACGCCTATAA
NAFlex_lks2 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 CTAGGTGGATGACTCATT
NAFlex_lks3 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 CACGGAACCGGTTCCGTG
NAFlex_lks4 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 GGCGCGCACCACGCGCGG
NAFlex_oxyQ 1JRN Dna - parmBSC1 TIP3P DNA Quadruplex Naked ParmBSC1 TIP3P AddedSalt Loop Telomer 1,000 GGGGTTTTGGGG
NAFlex_1zgw 1ZGW Dna B parmBSC1 SPCE DNA-B Duplex ParmBSC1 SPC/E AddedSalt 1,000 GCAAATTAAAGCGCAAGA
NAFlex_1yo5 1YO5 Dna B parmBSC1 SPCE DNA-B Duplex ParmBSC1 SPC/E AddedSalt 1,000 ACACATCCTGCTA
NAFlex_1hlv 1HLV Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc ParmBSC1 SPC/E AddedSalt 1,000 AATCCCGTTTCCAACGAAGGC
NAFlex_1j5n 1J5N Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 CTGAACAATCACCCC
NAFlex_1iv6 1IV6 Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 CCCTAACCCTAAC
NAFlex_DDD_II_1 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DDD_II_2 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DSpcCheatham 1BNA Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DSpcDang 1BNA Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DTipCheatham 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_2hdc 1HLV Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc ParmBSC1 SPC/E AddedSalt 1,000 GCTTAAAATAACAATAC
NAFlex_miniABC_K_1 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAACGTGCTATGGAAGC
NAFlex_miniABC_K_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_K_9 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGTTAGATTAAAATTGC
NAFlex_miniABC_Na_2 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAATAAGTACCAGGAGC
NAFlex_miniABC_Na_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_NaK_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTTGTGACGGCTAGGGC
NAFlex_miniABC_NaK_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_K_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_K_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAGGCGCAAGACTGAGC
NAFlex_miniABC_Na_1 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAACGTGCTATGGAAGC
NAFlex_miniABC_Na_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_Na_9 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGTTAGATTAAAATTGC
NAFlex_miniABC_NaK_2 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAATAAGTACCAGGAGC
NAFlex_miniABC_NaK_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_K_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTGATATACGATGCAGC
NAFlex_miniABC_K_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_Na_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_Na_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAGGCGCAAGACTGAGC
NAFlex_miniABC_NaK_1 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAACGTGCTATGGAAGC
NAFlex_miniABC_NaK_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_NaK_9 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGTTAGATTAAAATTGC
NAFlex_miniABC_K_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_K_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGAACTCAAAGGTTGGC
NAFlex_miniABC_Na_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTGATATACGATGCAGC
NAFlex_miniABC_Na_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_NaK_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_NaK_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAGGCGCAAGACTGAGC
NAFlex_miniABC_K_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTTGTGACGGCTAGGGC
NAFlex_miniABC_K_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_Na_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_Na_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGAACTCAAAGGTTGGC
NAFlex_miniABC_NaK_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTGATATACGATGCAGC
NAFlex_miniABC_NaK_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_K_2 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAATAAGTACCAGGAGC
NAFlex_miniABC_K_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_Na_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTTGTGACGGCTAGGGC
NAFlex_miniABC_Na_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_NaK_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_NaK_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGAACTCAAAGGTTGGC
NAFlex_Z-DNA-4M 1I0T Dna Z parmBSC1 TIP3P DNA-Z Duplex Naked ParmBSC1 TIP3P AddedSalt 946 CGCGCGCGCG
NAFlex_2rn1 2RN1 Rna A parmBSC0 TIP3P RNA-A Naked ParmBSC0 TIP3P Electroneutral TAR Hairpin-loops Aptamer Kissing-loops 906 GAGCCCUGGGAGGCUC
NAFlex_DDD_800ns 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 800 CGCGAATTCGCG
NAFlex_Subi 1GQU Dna DNA hoogsteen parmBSC1 TIP3P DNA-Hoogsteen Duplex Naked ParmBSC1 TIP3P Electroneutral Flipout-bases Overhanging-bases 720 ATATATATATAT
NAFlex_groovebinder 2DND Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral minor-groove-binder 700 CGCAAATTTGCG
NAFlex_2hkb 2HKB Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 CTCGGCGCCATC
NAFlex_2k0v 2K0V Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 CCTCTGGTCTCC
NAFlex_2l8q 2L8Q Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 CGCATGCTACGC
NAFlex_2lwg 2LWG Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 GGATATATCC
NAFlex_2m2c 2M2C Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 GCGCATGCTACGCG
NAFlex_2nq1 2NQ1 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 CCTCAGGCCTCC
NAFlex_AAf NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ModifiedNucleotides ParmBSC1 TIP3P Electroneutral 500 CCATACAATACGG
NAFlex_ACGT NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGACGTCGCG
NAFlex_CTAG_10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCGCGCTAGCGCGGC
NAFlex_CTAG_11 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTACTAGAGAGGC
NAFlex_CTAG_12 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTACTAGCGAGGC
NAFlex_CTAG_13 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTACTAGGGAGGC
NAFlex_CTAG_15 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTCCTAGAGAGGC
NAFlex_CTAG_16 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTCCTAGCGAGGC
NAFlex_CTAG_17 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTCCTAGGGAGGC
NAFlex_CTAG_18 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTGCTAGAGAGGC
NAFlex_CTAG_19 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTGCTAGCGAGGC
NAFlex_CTAG_2 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTCCTAGGAGAGC
NAFlex_CTAG_20 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTTCTAGAGAGGC
NAFlex_CTAG_21 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGACTAGACTCGC
NAFlex_CTAG_22 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGACTAGCCTCGC
NAFlex_CTAG_23 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGACTAGGCTCGC
NAFlex_CTAG_24 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGACTAGTCTCGC
NAFlex_CTAG_25 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGCCTAGACTCGC
NAFlex_CTAG_26 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGCCTAGCCTCGC
NAFlex_CTAG_27 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGCCTAGGCTCGC
NAFlex_CTAG_28 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGGCTAGACTCGC
NAFlex_CTAG_29 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGGCTAGCCTCGC
NAFlex_CTAG_3 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGAAAACTAGAAAAGC
NAFlex_CTAG_30 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGTCTAGACTCGC
NAFlex_CTAG_31 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCTAGCTAGCTAGGC
NAFlex_CTAG_32 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCTAGCTAGCTAGGC
NAFlex_CTAG_4 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGAAAACTAGTTTTGC
NAFlex_CTAG_5 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGATATCTAGATATGC
NAFlex_CTAG_6 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTATACTAGTATAGC
NAFlex_CTAG_7 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGGGGCTAGGGGGGC
NAFlex_CTAG_8 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGGGGCTAGCCCCGC
NAFlex_CTAG_9 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGCGCCTAGGCGCGC
NAFlex_CTAG_flex NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCTCTCTAGAGAGGC
NAFlex_CTAG_rig NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCAAGCTAGCTTGGC
NAFlex_GGf NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ModifiedNucleotides ParmBSC1 TIP3P Electroneutral 500 CCATACGATACGG
NAFlex_TCGA NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGTCGACGCG
NAFlex_TCGAhmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGTXGACGCG
NAFlex_TCGAmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGTXGACGCG
NAFlex_CTAG_14 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTACTAGTGAGGC
NAFlex_FOXO3_crystal_rep0 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 500 GACTATGTAAACAACGC
NAFlex_apsGGC NONE Dna Anti parallel triplex GGC parmBSC1 TIP3P DNA Triplex Naked ParmBSC1 TIP3P Electroneutral 440 GGGGGGGGGG | CCCCCCCCCC | GGGGGGGGGG
NAFlex_psATT NONE Dna parallel triplex ATT parmBSC1 TIP3P DNA Triplex Naked ParmBSC1 TIP3P Electroneutral 440 AAAAAAAAAA | TTTTTTTTTT | TTTTTTTTTT
NAFlex_psGGC NONE Dna parallel triplex GGC parmBSC1 TIP3P DNA Triplex Naked ParmBSC1 TIP3P Electroneutral 440 GGGGGGGGGG | CCCCCCCCCC | GGGGGGGGGG
NAFlex_QAPS 156D Dna anti parallel quadruplex parmBSC1 TIP3P DNA Dimeric Quadruplex Telomeric Naked ParmBSC1 TIP3P Electroneutral 440 GGGG | GGGG | GGGG | GGGG
NAFlex_QPS 352D Dna parallel quadruplex parmBSC1 TIP3P DNA Quadruplex Naked ParmBSC1 TIP3P Electroneutral Parallel 440 GGGG | GGGG | GGGG | GGGG
NAFlex_2af1-H-DNA 2AF1 Dna H parmBSC1 TIP3P DNA-B Duplex Naked Hoogsteen ParmBSC1 TIP3P Electroneutral Overhanging-bases 400 CGATATATATAT
NAFlex_PYR NONE Dna DNA unfolding parmBSC1 TIP3P DNA Duplex Naked ParmBSC1 TIP3P Electroneutral 400 GGCGCC
NAFlex_Z-DNA-0M 1I0T Dna Z parmBSC1 TIP3P DNA-Z Duplex Naked ParmBSC1 TIP3P Electroneutral 385 CGCGCGCGCG
NAFlex_ACGThmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 250 CGCGAXGTCGCG
NAFlex_ACGTmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 250 CGCGAXGTCGCG
NAFlex_rna2 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 250 CUAGGUGGAUGACUCAUU
NAFlex_apsAAT NONE Dna Anti parallel triplex AAT parmBSC1 TIP3P DNA Triplex Naked ParmBSC1 TIP3P Electroneutral 240 AAAAAAAAAA | TTTTTTTTTT | AAAAAAAAAA
NAFlex_ZDNA NONE Dna Z parmBSC1 TIP3P DNA-Z Duplex Naked ParmBSC1 TIP3P Electroneutral 240 CGCGCGCGCG
NAFlex_rna3 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 202 CACGGAACCGGUUCCGUC
NAFlex_rna4 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 201 GGCGCGCACCACGCGCGG
NAFlex_1fzx 1FZX Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral A-track 200 GGCAAAAAACGG
NAFlex_1sk5 1SK5 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral A-track 200 CTTTTAAAAG
NAFlex_1vt5 1VT5 Dna A parmBSC1 TIP3P DNA-A Duplex Naked ParmBSC1 TIP3P Electroneutral 200 CCCCGGGG
NAFlex_440d 440D Dna A parmBSC1 TIP3P DNA-A Duplex Naked ParmBSC1 TIP3P Electroneutral 200 AGGGGCCCCT
NAFlex_rna1 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 200 GCCUAUAAACGCCUAUAA
NAFlex_1rvh 1RVH Dna B parmBSC1 TIP3P DNA-B ParmBSC1 PhysiologicalTemp TIP3P Electroneutral Dang Duplex 200 GCAAAATTTTGC
NAFlex_A-Ethanol 1BNA Dna A (in ethanol) parmBSC1 Wat-Ethanol DNA-A Duplex Naked ParmBSC1 Water-Ethanol Electroneutral 200 CGCGAATTCGCG
NAFlex_1d89 1D89 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 200 CGCGAAAAAACG
NAFlex_DDD_GMX_CPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_GMX_GPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_Amber_CPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_Amber_GPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_FOXA3_crystal_rep0 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep1 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep2 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep3 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep4 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep5 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_mut_rep0 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep1 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep2 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep3 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep4 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep5 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_mut_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_crystal_rep1 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep2 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep3 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep4 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep5 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_dna_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_A2B_1 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_2 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_3 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_4 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_5 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG