Entry: NAFlex_2lpw
MD Simulation >> (Click to expand/shrink)
| Simulation Metadata | |
|---|---|
| Force Field | parmBSC1 |
| Simulation Date | 2015-May-06 |
| Simulated Time | 5,000 ns |
| Time Step | 1ns |
| Parts | DNA |
| Temperature | 298K |
| Water | TIP3P |
| Additional Solvent | No |
| Counter Ions | K+ |
| Ionic Concentration | Electroneutrality |
| Additional Ions | No |
| Additional Molecules | No |
| Ions Parameters | Dang |
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
(Click to see full UMM)
| Simulation Metadata (UMM) | |
|---|---|
| AdditionalIons | No |
| AdditionalMolecules | No |
| AdditionalSolvent | No |
| Author | G.P. |
| Chains | single quadruplex |
| Comments | - |
| CounterIons | K+ |
| Format | xtc |
| FrameStep | 1ns |
| Frames | 5000 |
| IonicConcentration | Electroneutrality |
| IonsParameters | Dang |
| Ligands | No |
| NucType | DNA |
| PDB | 2LPW |
| Parts | DNA |
| RMSd_avg | 5.724 |
| RMSd_stdev | 1.059 |
| Rgyr_avg | 12.204 |
| Rgyr_stdev | 0.503 |
| SASA_avg | 968.868 |
| SASA_stdev | 250.187 |
| SubType | G-loop |
| Temperature | 298K |
| Topology | init_2lpw.pdb |
| Trajectory | 2lpw_bsc1_5mic.xtc |
| Water | TIP3P |
| _id | NAFlex_2lpw |
| authors | Ivan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco |
| dataset | Array |
| date | 2015-May-06 |
| description | DNA Single Stranded Naked ParmBSC1 TIP3P Electroneutral G-Loop |
| forceField | parmBSC1 |
| ionsModel | - |
| moleculeType | Dna |
| rev_sequence | - |
| saltConcentration | - |
| sequence | AAGGGTGGGTGTAAGTGTGGGTGGGT |
| soluteAtoms | 846 |
| soluteCharge | 846 |
| soluteResidues | 26 |
| solventAtoms | - |
| solventResidues | - |
| time | 5,000 |
| totalAtoms | 846 |
| totalCharge | 846 |
| totalIons | - |
| totalResidues | 26 |
| Quality Control | |
|---|---|
| RMSd | 5.724 (1.059) Å  |
| Rgyr | 12.204 (0.503) Å  |
| SASA | 968.868 (250.187) Ų  |
| RMSf |  |
