Entry: NAFlex_1anr


Nucleic Acid Data:


SequenceGGCAGAUCUGAGCCUGGGAGCUCUCUGCC
Rev. Sequence-
TypeRNA
SubTypeA
Chainssingle
Pdb1ANR [PDB] [NDB]
LigandsNo
KeywordsRNA-A Single Stranded HIV-1 TAR Naked ParmBSC0 TIP3P Electroneutral internal-loops hairpin-loops


Simulation Metadata
Force FieldparmBSC1
Simulation Date2014-Feb-19
Simulated Time4,939 ns
Time Step0.1ns
Partsonly RNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorI.F.
Chainssingle
CommentsTAR HIV-1 from several replica
CounterIonsNa+
Formatndcf
FrameStep0.1ns
Frames49395
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeRNA
PDB1ANR
Partsonly RNA
RMSd_avg6.993
RMSd_stdev2.459
Rgyr_avg0.000
Rgyr_stdev0.000
SASA_avg0.000
SASA_stdev0.000
SubTypeA
Temperature300K
Topologytar.vac.top
Trajectorytar.dry.nc
WaterTIP3P
_idNAFlex_1anr
altPDB1ANR 1ARJ 1UTS 1UUD 1UUI 2KDQ 2KX5 2L8H
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2014-Feb-19
descriptionRNA-A Single Stranded HIV-1 TAR Naked ParmBSC0 TIP3P Electroneutral internal-loops hairpin-loops
forceFieldparmBSC0
ionsModel-
moleculeTypeRna
rev_sequence-
saltConcentration-
sequenceGGCAGAUCUGAGCCUGGGAGCUCUCUGCC
soluteAtoms930
soluteCharge-28
soluteResidues29
solventAtoms-
solventResidues-
time4,939
totalAtoms930
totalCharge-28
totalIons-
totalResidues29
Quality Control
RMSd6.993 (2.459) Å    
Rgyr
SASA
RMSf