Entry: NAFlex_1hlv


Nucleic Acid Data:


SequenceAATCCCGTTTCCAACGAAGGC
Rev. SequenceGCCTTCGTTGGAAACGGGATT
TypeDNA
SubTypeB
Chainsduplex
Pdb1HLV [PDB] [NDB]
LigandsNo
KeywordsDNA-B Duplex Protein-Nuc ParmBSC1 SPC/E AddedSalt


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Aug-07
Simulated Time1,000 ns
Time Step1 ps
PartsDNA+protein+ions
Temperature298K
WaterSPCE
Additional SolventNo
Counter IonsK+Cl-
Ionic Concentration0.15M
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorF.B.
Chainsduplex
Comments-
CounterIonsK+Cl-
Formatnetcdf
FrameStep1 ps
Frames1000000
IonicConcentration0.15M
IonsParametersDang
LigandsNo
NucTypeDNA
PDB1HLV
PartsDNA+protein+ions
RMSd_avg2.129
RMSd_stdev0.507
Rgyr_avg20.924
Rgyr_stdev0.575
SASA_avg7432.181
SASA_stdev187.874
SubTypeB
Temperature298K
Topologyf1hlv_nowat.prmtop
Trajectoryf1hlv_nowat.nc
WaterSPCE
_idNAFlex_1hlv
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
boxAngle109.471219
boxX86.2381964
boxY86.2381964
boxZ86.2381964
datasetArray
date2015-Aug-07
descriptionDNA-B Duplex Protein-Nuc ParmBSC1 SPC/E AddedSalt
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceGCCTTCGTTGGAAACGGGATT
saltConcentration-
sequenceAATCCCGTTTCCAACGAAGGC
soluteAtoms1331
soluteCharge-40
soluteResidues42
solventAtoms-
solventResidues-
time1,000
totalAtoms1331
totalCharge-40
totalIons-
totalResidues42
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-