Entry: NAFlex_2mhi


Nucleic Acid Data:


SequenceGGAAACGCCGCGGUCAGCUCGGCUGCUGCGAAGAGUUCGUCUCUGUUGUUUCC
Rev. Sequence-
TypeRNA
SubTypeA
Chainsduplex
Pdb2MHI [PDB] [NDB]
LigandsNo
KeywordsRNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral Telomerase


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-25
Simulated Time1,027 ns
Time Step100ps
Partsonly RNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorI.F.
Chainsduplex
Comments-
CounterIonsNa+
Formatncdf
FrameStep100ps
Frames10274
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeRNA
PDB2MHI
Partsonly RNA
RMSd_avg8.723
RMSd_stdev3.454
Rgyr_avg18.181
Rgyr_stdev1.256
SASA_avg9206.988
SASA_stdev305.878
SubTypeA
Temperature300K
Topology2mhi.vac.top
Trajectory2mhi.dry.nc
WaterTIP3P
_idNAFlex_2mhi
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-25
descriptionRNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral Telomerase
forceFieldparmBSC0
ionsModel-
moleculeTypeRna
rev_sequence-
saltConcentration-
sequenceGGAAACGCCGCGGUCAGCUCGGCUGCUGCGAAGAGUUCGUCUCUGUUGUUUCC
soluteAtoms1693
soluteCharge-52
soluteResidues53
solventAtoms-
solventResidues-
time1,027
totalAtoms1693
totalCharge-52
totalIons-
totalResidues53
Quality Control
RMSd8.723 (3.454) Å    
Rgyr18.181 (1.256) Å    
SASA9206.988 (305.878) Ų    
RMSf