Entry: NAFlex_36merSPCE


Nucleic Acid Data:


SequenceCGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
Rev. SequenceCGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
TypeDNA
SubTypeB
Chainsduplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-24
Simulated Time300 ns
Time Step1ps
PartsDNA
Temperature300K
WaterSPCE
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorA.N.
Chainsduplex
Comments-
CounterIonsNa+
Formatmdcrd
FrameStep1ps
Frames300000
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA
RMSd_avg4.227
RMSd_stdev1.474
Rgyr_avg34.520
Rgyr_stdev0.710
SASA_avg12551.994
SASA_stdev185.825
SubTypeB
Temperature300K
Topology36mer.amb.top
Trajectory36mer.300ns.spce.trj
WaterSPCE
_idNAFlex_36merSPCE
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-24
descriptionDNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceCGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
saltConcentration-
sequenceCGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
soluteAtoms2282
soluteCharge-70
soluteResidues72
solventAtoms-
solventResidues-
time300
totalAtoms2282
totalCharge-70
totalIons-
totalResidues72
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-