Entry: NAFlex_437d


Nucleic Acid Data:


SequenceGGCGCGGCACCGUCCGCGGAACAAACGG
Rev. Sequence-
TypeRNA
SubTypeA
Chainssingle
Pdb437D [PDB] [NDB]
LigandsNo
KeywordsRNA-A Single Stranded Naked ParmBSC0 TIP3P Electroneutral Pseudoknot Flipout-bases Overhanging-bases Loops


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-25
Simulated Time1,015 ns
Time Step10ps
Partsonly RNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorI.F.
Chainssingle
Commentspseudoknot
CounterIonsNa+
Formatmdcrd
FrameStep10ps
Frames101506
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeRNA
PDB437D
Partsonly RNA
RMSd_avg3.893
RMSd_stdev0.414
Rgyr_avg12.321
Rgyr_stdev0.301
SASA_avg4482.699
SASA_stdev109.277
SubTypeA
Temperature300K
Topologypseudoknot.vac.top
Trajectorypseudoknot.dry.trj.gz
WaterTIP3P
_idNAFlex_437d
altPDB1L2X 1L3D 437D
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-25
descriptionRNA-A Single Stranded Naked ParmBSC0 TIP3P Electroneutral Pseudoknot Flipout-bases Overhanging-bases Loops
forceFieldparmBSC0
ionsModel-
moleculeTypeRna
rev_sequence-
saltConcentration-
sequenceGGCGCGGCACCGUCCGCGGAACAAACGG
soluteAtoms911
soluteCharge-27
soluteResidues28
solventAtoms-
solventResidues-
time1,015
totalAtoms911
totalCharge-27
totalIons-
totalResidues28
Quality Control
RMSd3.893 (0.414) Å    
Rgyr12.321 (0.301) Å    
SASA4482.699 (109.277) Ų    
RMSf