Entry: NAFlex_56merA


Nucleic Acid Data:


SequenceCGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
Rev. SequenceGCGCGGCATGGGGCATTTTTTTGAGCGCGCGCCTATTTTTTCGGCTACTGCCGGCG
TypeDNA
SubTypeB
Chainsduplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-21
Simulated Time360 ns
Time Step1ps
PartsDNA+ions
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsK+Cl-
Ionic Concentration0.15M
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorA.P.
Chainsduplex
Comments56mer seq3 UK / Esta en el directorio de Pablo
CounterIonsK+Cl-
Formatmdcrd
FrameStep1ps
Frames360000
IonicConcentration0.15M
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA+ions
RMSd_avg8.376
RMSd_stdev2.721
Rgyr_avg52.470
Rgyr_stdev1.226
SASA_avg19293.844
SASA_stdev280.136
SubTypeB
Temperature300K
Topologyf56merA_nowat.prmtop
Trajectoryf56merA_1-360.mdcrd
WaterTIP3P
_idNAFlex_56merA
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-21
descriptionDNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceGCGCGGCATGGGGCATTTTTTTGAGCGCGCGCCTATTTTTTCGGCTACTGCCGGCG
saltConcentration-
sequenceCGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
soluteAtoms3548
soluteCharge-110
soluteResidues112
solventAtoms-
solventResidues-
time360
totalAtoms3548
totalCharge-110
totalIons-
totalResidues112
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-