Entry: NAFlex_56merSPCE


Nucleic Acid Data:


SequenceCGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
Rev. SequenceCGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
TypeDNA
SubTypeB
Chainsduplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-21
Simulated Time290 ns
Time Step1ps
PartsDNA
Temperature300K
WaterSPCE
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorA.N.
Chainsduplex
Comments56mer seq1 SPCE
CounterIonsNa+
Formatmdcrd
FrameStep1ps
Frames290000
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA
RMSd_avg7.272
RMSd_stdev2.728
Rgyr_avg52.416
Rgyr_stdev1.214
SASA_avg19386.556
SASA_stdev280.914
SubTypeB
Temperature300K
Topology56mer.amb.top
Trajectory56mer.290ns.spce.trj
WaterSPCE
_idNAFlex_56merSPCE
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-21
descriptionDNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceCGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
saltConcentration-
sequenceCGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
soluteAtoms3550
soluteCharge-110
soluteResidues112
solventAtoms-
solventResidues-
time290
totalAtoms3550
totalCharge-110
totalIons-
totalResidues112
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-