Entry: NAFlex_56merSeq2


Nucleic Acid Data:


SequenceCGTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGCG
Rev. SequenceCGCACTTCTGAGTTCGGCATGGGGTCAGGTGGGACCACCGCGCTACTGCCGCCACG
TypeDNA
SubTypeB
Chainsduplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked Parm99 TIP3P Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-May-05
Simulated Time300 ns
Time Step1ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorA.N.
Chainsduplex
Comments56mer seq2
CounterIonsNa+
Formatxtc
FrameStep1ps
Frames300000
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA
RMSd_avg68.155
RMSd_stdev16.962
Rgyr_avg90.979
Rgyr_stdev14.100
SASA_avg9236.204
SASA_stdev674.403
SubTypeB
Temperature300K
Topology56seq2.gmx.top
Trajectory56seq2.300ns.xtc
WaterTIP3P
_idNAFlex_56merSeq2
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-May-05
descriptionDNA-B Duplex Naked Parm99 TIP3P Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceCGCACTTCTGAGTTCGGCATGGGGTCAGGTGGGACCACCGCGCTACTGCCGCCACG
saltConcentration-
sequenceCGTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGCG
soluteAtoms3544
soluteCharge3544
soluteResidues112
solventAtoms-
solventResidues-
time300
totalAtoms3544
totalCharge3544
totalIons-
totalResidues112
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-