Entry: NAFlex_56merTIP3P


Nucleic Acid Data:


SequenceCGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
Rev. SequenceCGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
TypeDNA
SubTypeB
Chainsduplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-21
Simulated Time500 ns
Time Step1ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorA.N.
Chainsduplex
Comments56mer seq1
CounterIonsNa+
Formatmdcrd
FrameStep1ps
Frames500000
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA
RMSd_avg7.445
RMSd_stdev2.861
Rgyr_avg52.537
Rgyr_stdev1.168
SASA_avg19411.833
SASA_stdev282.694
SubTypeB
Temperature300K
Topology56mer.amb.top
Trajectory56mer.500ns.tip3p.trj
WaterTIP3P
_idNAFlex_56merTIP3P
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-21
descriptionDNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceCGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
saltConcentration-
sequenceCGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
soluteAtoms3550
soluteCharge-110
soluteResidues112
solventAtoms-
solventResidues-
time500
totalAtoms3550
totalCharge-110
totalIons-
totalResidues112
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-