Entry: NAFlex_ProtDNA_1c7u


Nucleic Acid Data:


SequenceCTCGGCTATTAATAGCCGAG
Rev. SequenceCTCGGCTATTAATAGCCGAG
TypeProt-DNA
SubTypeB
Chainsduplex
Pdb1C7U [PDB] [NDB]
LigandsNo
KeywordsDNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2016-Jan-22
Simulated Time2,000 ns
Time Step2 ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorP.D.
Chainsduplex
CommentsProt-DNA study
CounterIonsNa+
Formatnetcdf
FrameStep2 ps
Frames1000000
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeProt-DNA
PDB1C7U
PartsDNA
RMSd_avg2.709
RMSd_stdev0.578
Rgyr_avg20.094
Rgyr_stdev0.396
SASA_avg7075.585
SASA_stdev106.102
SubTypeB
Temperature300K
Topologytopol.top
Trajectorytraj.nc
WaterTIP3P
_idNAFlex_ProtDNA_1c7u
boxAngle109.471219
boxX83.6848785
boxY83.6848785
boxZ83.6848785
datasetArray
date2016-Jan-22
descriptionDNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeProt-Dna
rev_sequenceCTCGGCTATTAATAGCCGAG
saltConcentration-
sequenceCTCGGCTATTAATAGCCGAG
soluteAtoms1268
soluteCharge-38
soluteResidues40
solventAtoms-
solventResidues-
time2,000
totalAtoms1268
totalCharge-38
totalIons-
totalResidues40
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-