Entry: NAFlex_ProtDNA_1hlv


Nucleic Acid Data:


SequenceAATCCCGTTTCCAACGAAGGC
Rev. SequenceGCCTTCGTTGGAAACGGGATT
TypeProt-DNA
SubTypeB
Chainsduplex
Pdb1HLV [PDB] [NDB]
LigandsNo
KeywordsDNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2016-Jan-22
Simulated Time2,000 ns
Time Step2 ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorP.D.
Chainsduplex
CommentsProt-DNA study
CounterIonsNa+
Formatnetcdf
FrameStep2 ps
Frames1000000
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeProt-DNA
PDB1HLV
PartsDNA
RMSd_avg2.582
RMSd_stdev0.618
Rgyr_avg21.000
Rgyr_stdev0.402
SASA_avg7430.197
SASA_stdev111.748
SubTypeB
Temperature300K
Topologytopol.top
Trajectorytraj.nc
WaterTIP3P
_idNAFlex_ProtDNA_1hlv
boxAngle109.471219
boxX86.2381964
boxY86.2381964
boxZ86.2381964
datasetArray
date2016-Jan-22
descriptionDNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeProt-Dna
rev_sequenceGCCTTCGTTGGAAACGGGATT
saltConcentration-
sequenceAATCCCGTTTCCAACGAAGGC
soluteAtoms1331
soluteCharge-40
soluteResidues42
solventAtoms-
solventResidues-
time2,000
totalAtoms1331
totalCharge-40
totalIons-
totalResidues42
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-