Entry: NAFlex_ProtDNA_4oi7


Nucleic Acid Data:


SequenceCACGTTCGTAGCATCGTTGCAG
Rev. SequenceCTGCAACGATGCTACGAACGTG
TypeDNA
SubTypeB
Chainsduplex
Pdb4OI7 [PDB] [NDB]
LigandsNo
KeywordsDNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2016-Jan-23
Simulated Time2,000 ns
Time Step2 ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+
Ionic ConcentrationElectroneutrality
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorP.D.
Chainsduplex
CommentsProt-DNA study
CounterIonsNa+
Formatnetcdf
FrameStep2 ps
Frames1000000
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeDNA
PDB4OI7
PartsDNA
RMSd_avg3.238
RMSd_stdev0.901
Rgyr_avg21.798
Rgyr_stdev0.429
SASA_avg7774.377
SASA_stdev117.384
SubTypeB
Temperature300K
Topologytopol.top
Trajectorytraj.nc
WaterTIP3P
_idNAFlex_ProtDNA_4oi7
boxAngle109.471219
boxX88.3951961
boxY88.3951961
boxZ88.3951961
datasetArray
date2016-Jan-23
descriptionDNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceCTGCAACGATGCTACGAACGTG
saltConcentration-
sequenceCACGTTCGTAGCATCGTTGCAG
soluteAtoms1394
soluteCharge-42
soluteResidues44
solventAtoms-
solventResidues-
time2,000
totalAtoms1394
totalCharge-42
totalIons-
totalResidues44
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-