Entry: NAFlex_TF_1hlv_16_dna_wholeB


Nucleic Acid Data:


SequenceGCCTTCGTTGGATGCXGGATT
Rev. SequenceAATCCCGCATCCAACGAAGGC
TypeDNA
SubTypeB
Chainsduplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked TIP3P Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2022-Jun-08
Simulated Time200 ns
Time Step2 ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsK+Cl-
Ionic ConcentrationElectroneutrality
Additional Ions150 mM
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIons150 mM
AdditionalMoleculesNo
AdditionalSolventNo
AuthorM.W.
Chainsduplex
CommentsMilosz MSCA
CounterIonsK+Cl-
Formatxtc
FrameStep2 ps
Frames250
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeDNA
PDB-
PartsDNA
RMSd_avg3.291
RMSd_stdev0.623
Rgyr_avg21.180
Rgyr_stdev0.568
SASA_avg7496.470
SASA_stdev175.825
SubTypeB
Temperature300K
Topologywhole.pdb
Trajectorywhole.xtc
WaterTIP3P
_idNAFlex_TF_1hlv_16_dna_wholeB
datasetArray
date2022-Jun-08
descriptionDNA-B Duplex Naked TIP3P Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceAATCCCGCATCCAACGAAGGC
saltConcentration-
sequenceGCCTTCGTTGGATGCXGGATT
soluteAtoms1332
soluteCharge-
soluteResidues42
solventAtoms-
solventResidues-
time200
totalAtoms1332
totalCharge-
totalIons-
totalResidues42
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-