Entry: NAFlex_TT_SSB2


Nucleic Acid Data:


SequenceXXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXTGCTTAAACXTACGTACGCGXTGTCCCCCGXTTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
Rev. SequenceCTGTACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAAAACGGGGGACAACGCGTACGTAAGTTTAAGCAATGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCC
TypeProt+DNA
SubTypeB
Chainsduplex
Pdb-
LigandsNo
Keywords-B Duplex Naked TIP3P Electroneutral


Simulation Metadata
Force FieldparmBSC1
Simulation Date2022-Jun-03
Simulated Time200 ns
Time Step2 ps
PartsProt+DNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsK+Cl-
Ionic ConcentrationElectroneutrality
Additional Ions150 mM
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIons150 mM
AdditionalMoleculesNo
AdditionalSolventNo
AuthorM.W.
Chainsduplex
CommentsMilosz MSCA
CounterIonsK+Cl-
Formatxtc
FrameStep2 ps
Frames250
IonicConcentrationElectroneutrality
IonsParametersDang
LigandsNo
NucTypeProt+DNA
PDB-
PartsProt+DNA
RMSd_avg3.294
RMSd_stdev0.322
Rgyr_avg37.143
Rgyr_stdev2.206
SASA_avg81489.097
SASA_stdev4906.328
SubTypeB
Temperature300K
Topologywhole.pdb
Trajectorywhole.xtc
WaterTIP3P
_idNAFlex_TT_SSB2
datasetArray
date2022-Jun-03
description-B Duplex Naked TIP3P Electroneutral
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceCTGTACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAAAACGGGGGACAACGCGTACGTAAGTTTAAGCAATGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCC
saltConcentration-
sequenceXXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXTGCTTAAACXTACGTACGCGXTGTCCCCCGXTTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
soluteAtoms22385
soluteCharge-
soluteResidues1098
solventAtoms-
solventResidues-
time200
totalAtoms22385
totalCharge-
totalIons-
totalResidues1098
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-