Entry: NAFlex_Tirr_RNA_hairpin
Nucleic Acid Data:
| Sequence | GGACAAGAUGCCUUAUGUGGACUUCACCACAUAAGGCAUCUUGUCC |
| Rev. Sequence | - |
| Type | RNA |
| SubType | A |
| Chains | hairpin |
| Pdb | - |
| Ligands | No |
| Keywords | RNA-A Protein-Nuc TIP3P AddedSalt |
MD Simulation >> (Click to expand/shrink)
| Simulation Metadata | |
|---|---|
| Force Field | parmBSC0+OL3 |
| Simulation Date | 2022-Sep-05 |
| Simulated Time | 1,000 ns |
| Time Step | 20 ps |
| Parts | RNA+protein_Tirr |
| Temperature | 298K |
| Water | TIP3P |
| Additional Solvent | No |
| Counter Ions | K+ |
| Ionic Concentration | 0.15M |
| Additional Ions | KCl |
| Additional Molecules | No |
| Ions Parameters | Dang |
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
(Click to see full UMM)
| Simulation Metadata (UMM) | |
|---|---|
| AdditionalIons | KCl |
| AdditionalMolecules | No |
| AdditionalSolvent | No |
| Author | F.B. |
| Chains | hairpin |
| Comments | - |
| CounterIons | K+ |
| Format | nc |
| FrameStep | 20 ps |
| Frames | 1000000 |
| IonicConcentration | 0.15M |
| IonsParameters | Dang |
| Ligands | No |
| NucType | RNA |
| PDB | NONE |
| Parts | RNA+protein_Tirr |
| SubType | A |
| Temperature | 298K |
| Topology | mon3_hairpinl_nowat.NAFlex.prmtop |
| Trajectory | mon3_hairpinlmd_reimage.5000.nc |
| Water | TIP3P |
| _id | NAFlex_Tirr_RNA_hairpin |
| dataset | Array |
| date | 2022-Sep-05 |
| description | RNA-A Protein-Nuc TIP3P AddedSalt |
| forceField | parmBSC0+OL3 |
| ionsModel | - |
| moleculeType | Prot-Rna |
| rev_sequence | - |
| saltConcentration | - |
| sequence | GGACAAGAUGCCUUAUGUGGACUUCACCACAUAAGGCAUCUUGUCC |
| soluteAtoms | 4676 |
| soluteCharge | -41 |
| soluteResidues | 248 |
| solventAtoms | - |
| solventResidues | - |
| time | 1,000 |
| totalAtoms | 4676 |
| totalCharge | -41 |
| totalIons | - |
| totalResidues | 248 |
| Quality Control | |
|---|---|
| RMSd |  |
| Rgyr |  |
| SASA |  |
| RMSf |  |