Entry: NAFlex_v100t9


Nucleic Acid Data:


SequenceATCTTGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGTTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
Rev. SequenceATCCTCACCTGCATCCTGAACCCATTGACTCCCAACCCCGTAACGATAGGCCTTGATGTCGATAGCATTGCACGGGTCTTGTTCGATTAACTGCCAAGAT
TypeDNA
SubTypeB
Chainscircular duplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked Parm99 TIP3P AddedSalt


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-27
Simulated Time100 ns
Time Step1ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+Cl-
Ionic Concentration0.2M
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorA.N.
Chainscircular duplex
Comments100 bp 9 turns
CounterIonsNa+Cl-
Formatxtc
FrameStep1ps
Frames100000
IonicConcentration0.2M
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA
RMSd_avg92.856
RMSd_stdev14.266
Rgyr_avg91.406
Rgyr_stdev8.553
SASA_avg18215.838
SASA_stdev990.054
SubTypeB
Temperature300K
Topologyv100t9.gmx.gro
Trajectoryv100t9.all.lowres.xtc
WaterTIP3P
_idNAFlex_v100t9
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-27
descriptionDNA-B Duplex Naked Parm99 TIP3P AddedSalt
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceATCCTCACCTGCATCCTGAACCCATTGACTCCCAACCCCGTAACGATAGGCCTTGATGTCGATAGCATTGCACGGGTCTTGTTCGATTAACTGCCAAGAT
saltConcentration-
sequenceATCTTGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGTTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
soluteAtoms6350
soluteCharge6350
soluteResidues200
solventAtoms-
solventResidues-
time100
totalAtoms6350
totalCharge6350
totalIons-
totalResidues200
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-