Entry: NAFlex_v106t9


Nucleic Acid Data:


SequenceATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
Rev. SequenceATCCTCACCTGCATCCTGAACCCATTGACTCCCAACCCCGTAATAGCGATAGGCCTTGATGTCGATAGCATTGCACGGGTCTTGTTCGATTAACTGCCGCAAAGAT
TypeDNA
SubTypeB
Chainscircular duplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked Parm99 TIP3P AddedSalt


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-27
Simulated Time50 ns
Time Step1ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+Cl-
Ionic Concentration0.2M
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorA.N.
Chainscircular duplex
Comments106bp 9 turns
CounterIonsNa+Cl-
Formatxtc
FrameStep1ps
Frames50000
IonicConcentration0.2M
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA
RMSd_avg28.746
RMSd_stdev7.433
Rgyr_avg50.238
Rgyr_stdev2.392
SASA_avg15997.030
SASA_stdev579.811
SubTypeB
Temperature300K
Topologyv106t9.gmx.gro
Trajectoryv106t9.all.lowres.xtc
WaterTIP3P
_idNAFlex_v106t9
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-27
descriptionDNA-B Duplex Naked Parm99 TIP3P AddedSalt
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceATCCTCACCTGCATCCTGAACCCATTGACTCCCAACCCCGTAATAGCGATAGGCCTTGATGTCGATAGCATTGCACGGGTCTTGTTCGATTAACTGCCGCAAAGAT
saltConcentration-
sequenceATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
soluteAtoms6731
soluteCharge6731
soluteResidues212
solventAtoms-
solventResidues-
time50
totalAtoms6731
totalCharge6731
totalIons-
totalResidues212
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-