Entry: NAFlex_1anr
Nucleic Sequence:
| Sequence | GGCAGAUCUGAGCCUGGGAGCUCUCUGCC |
| Rev. Sequence | - |
| Type | RNA |
| SubType | A |
| Chains | single |
| Pdb | 1ANR |
| Ligands | No |
MD Simulation >> (Click to expand/shrink)
| Force Field | parmBSC1 |
| Simulated Time | 4,939 ns |
| Time Step | 0.1ns |
| Parts | only RNA |
| Temperature | 300K |
| Water Model | TIP3P |
| Additional Solvent | No |
| Counter Ions | Na+ |
| Ionic Concentration | Electroneutrality |
| Additional Ions | No |
| Additional Molecules | No |
| Ions Parameters | Dang |
| RMSd | 6.993 (2.459) Å  |
| RMSf |  |
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
(Click to see full UMM)
| AdditionalIons | No |
| AdditionalMolecules | No |
| AdditionalSolvent | No |
| Author | I.F. |
| Chains | single |
| Comments | TAR HIV-1 from several replica |
| CounterIons | Na+ |
| Format | ndcf |
| FrameStep | 0.1ns |
| Frames | 49395 |
| IonicConcentration | Electroneutrality |
| IonsParameters | Dang |
| Ligands | No |
| NucType | RNA |
| PDB | 1anr |
| Parts | only RNA |
| RMSd_avg | 6.993 |
| RMSd_stdev | 2.459 |
| Rgyr_avg | 0.000 |
| Rgyr_stdev | 0.000 |
| SASA_avg | 0.000 |
| SASA_stdev | 0.000 |
| SubType | A |
| Temperature | 300K |
| Topology | tar.vac.top |
| Trajectory | tar.dry.nc |
| Water | TIP3P |
| _id | NAFlex_1anr |
| altPDB | 1ANR 1ARJ 1UTS 1UUD 1UUI 2KDQ 2KX5 2L8H |
| authors | Ivan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco |
| dataset | Array |
| date | 0.00000000 1392768000 |
| description | RNA-A Single Stranded HIV-1 TAR Naked ParmBSC0 TIP3P Electroneutral internal-loops hairpin-loops |
| forceField | parmBSC1 |
| ionsModel | - |
| moleculeType | Rna |
| rev_sequence | - |
| saltConcentration | - |
| sequence | GGCAGAUCUGAGCCUGGGAGCUCUCUGCC |
| soluteAtoms | 930 |
| soluteCharge | -28 |
| soluteResidues | 29 |
| solventAtoms | - |
| solventResidues | - |
| time | 4,939 |
| totalAtoms | 930 |
| totalCharge | -28 |
| totalIons | - |
| totalResidues | 29 |
