Entry: NAFlex_HTQ
Nucleic Sequence:
| Sequence | AGGGTTAGGGTTAGGGTTAGGG |
| Rev. Sequence | - |
| Type | DNA |
| SubType | G-loop |
| Chains | quadruplex |
| Pdb | 1KF1 |
| Ligands | No |
MD Simulation >> (Click to expand/shrink)
| Force Field | parmBSC1 |
| Simulated Time | 1,000 ns |
| Time Step | 2ps |
| Parts | DNA+ions |
| Temperature | 300K |
| Water Model | TIP3P |
| Additional Solvent | No |
| Counter Ions | K+ |
| Ionic Concentration | Electroneutrality |
| Additional Ions | No |
| Additional Molecules | No |
| Ions Parameters | Dang |
| RMSd | 3.659 (0.487) Å  |
| RMSf |  |
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
(Click to see full UMM)
| AdditionalIons | No |
| AdditionalMolecules | No |
| AdditionalSolvent | No |
| Author | I.I. |
| Chains | quadruplex |
| Comments | - |
| CounterIons | K+ |
| Format | mdcrd |
| FrameStep | 2ps |
| Frames | 500000 |
| IonicConcentration | Electroneutrality |
| IonsParameters | Dang |
| Ligands | No |
| NucType | DNA |
| PDB | 1KF1 |
| Parts | DNA+ions |
| RMSd_avg | 3.659 |
| RMSd_stdev | 0.487 |
| Rgyr_avg | 11.485 |
| Rgyr_stdev | 0.283 |
| SASA_avg | 3766.961 |
| SASA_stdev | 107.267 |
| SubType | G-loop |
| Temperature | 300K |
| Topology | no_wat.top |
| Trajectory | HTQ/with3ions.x.gz |
| Water | TIP3P |
| _id | NAFlex_HTQ |
| altPDB | 143D 1KF1 2E4I 2MCC 2MCO 3R6R 3SC8 3T5E 3UYH 4FXM 4G0F |
| authors | Ivan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco |
| dataset | Array |
| date | 0.00000000 1429920000 |
| description | DNA Single-Stranded G-Loop Naked ParmBSC1 TIP3P Electroneutral Telomer |
| forceField | parmBSC1 |
| ionsModel | - |
| moleculeType | Dna |
| rev_sequence | - |
| saltConcentration | - |
| sequence | AGGGTTAGGGTTAGGGTTAGGG |
| soluteAtoms | 715 |
| soluteCharge | -21 |
| soluteResidues | 22 |
| solventAtoms | - |
| solventResidues | - |
| time | 1,000 |
| totalAtoms | 715 |
| totalCharge | -21 |
| totalIons | - |
| totalResidues | 22 |
