Search Info:

Sequence: ACGA


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_ProtDNA_1h9t 1H9T Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CATCTGGTACGACCAGATC
NAFlex_ProtDNA_1hlv 1HLV Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AATCCCGTTTCCAACGAAGGC
NAFlex_ProtDNA_2kdz 2KDZ Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 AAGATAACGATATTTA
NAFlex_2oue 2OUE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral Flipout-bases Overhanging-bases Hammerhead Ribozyme Bulges 1,065 UCCCXGUCCACCG | CGGUGAGAAGGG | GGCAGAGAAACACACGA
NAFlex_1hlv 1HLV Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc ParmBSC1 SPC/E AddedSalt 1,000 AATCCCGTTTCCAACGAAGGC
NAFlex_muGAAC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCACGAACGAACGAACGC
NAFlex_miniABC_K_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTGATATACGATGCAGC
NAFlex_miniABC_Na_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTGATATACGATGCAGC
NAFlex_miniABC_NaK_11 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTGATATACGATGCAGC
NAFlex_GGf NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ModifiedNucleotides ParmBSC1 TIP3P Electroneutral 500 CCATACGATACGG
NAFlex_36merSPCE NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 300 CGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
NAFlex_36merTIP3P NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 300 CGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG