Search Info:

Sequence: CCGG


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_ProtDNA_2stw 2STW Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 TCGAACTTCCGGCTCGA
NAFlex_1dcw 1DCW Dna B parmBSC1 TIP3P DNA-B HollidayJunction Naked ParmBSC1 TIP3P Electroneutral 4way-junction inverted-repeat 1,000 CCGGTACCGG | CCGGTACCGG | CCGGTACCGG
NAFlex_lks3 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 CACGGAACCGGTTCCGTG
NAFlex_muCGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCCGGCCGGCCGGCGC
NAFlex_miniABC_Na_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_NaK_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_K_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_56merL NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_56merB NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 440 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_56merA NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 360 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_rna3 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 202 CACGGAACCGGUUCCGUC
NAFlex_1vt5 1VT5 Dna A parmBSC1 TIP3P DNA-A Duplex Naked ParmBSC1 TIP3P Electroneutral 200 CCCCGGGG