Search Info:

Sequence: TCGC


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_D05M 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 3,000 CGCGAATTCGCG
NAFlex_DTipDang015M 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 2,000 CGCGAATTCGCG
NAFlex_BSC1-BSC0 1NAJ Dna B parmBSC0 TIP3P DNA-B Duplex Naked TIP3P Electroneutral ParmBSC0 1,500 CGCGAATTCGCG
NAFlex_BSC1-C36 1NAJ Dna B Charmm36 TIP3P DNA-B Duplex Naked Charmm36 TIP3P Electroneutral 1,500 CGCGAATTCGCGCGCGAATTCGCG
NAFlex_BSC1-Garcia 1NAJ Dna B ParmBSC0-CG TIP3P DNA-B Duplex Naked Cheng-Garcia TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL1 1NAJ Dna B ParmBSC0-OL1 TIP3P DNA-B Duplex Naked OL1 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL1-OL4 1NAJ Dna B ParmBSC0-OL1-OL4 TIP3P DNA-B Duplex Naked OL1+OL4 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL4 1NAJ Dna B ParmBSC0-OL4 TIP3P DNA-B Duplex Naked OL4 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_DDD_II 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,200 CGCGAATTCGCG
NAFlex_DDD_II_1 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DDD_II_2 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DSpcCheatham 1BNA Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DSpcDang 1BNA Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DTipCheatham 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_muAGTC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTCAGTCAGTCAGTCGC
NAFlex_muTGTC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCTCTGTCTGTCTGTCGC
NAFlex_DDD_800ns 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 800 CGCGAATTCGCG
NAFlex_56merTIP3P NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
NAFlex_ACGT NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGACGTCGCG
NAFlex_CTAG_21 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGACTAGACTCGC
NAFlex_CTAG_22 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGACTAGCCTCGC
NAFlex_CTAG_23 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGACTAGGCTCGC
NAFlex_CTAG_24 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGACTAGTCTCGC
NAFlex_CTAG_25 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGCCTAGACTCGC
NAFlex_CTAG_26 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGCCTAGCCTCGC
NAFlex_CTAG_27 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGCCTAGGCTCGC
NAFlex_CTAG_28 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGGCTAGACTCGC
NAFlex_CTAG_29 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGGCTAGCCTCGC
NAFlex_CTAG_30 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGAGTCTAGACTCGC
NAFlex_colibactin1 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 400 CGCGAAAATTTTCGCG
NAFlex_36merSPCE NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 300 CGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
NAFlex_36merTIP3P NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 300 CGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
NAFlex_56merSPCE NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 290 CGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
NAFlex_ACGThmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 250 CGCGAXGTCGCG
NAFlex_ACGTmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 250 CGCGAXGTCGCG
NAFlex_A-Ethanol 1BNA Dna A (in ethanol) parmBSC1 Wat-Ethanol DNA-A Duplex Naked ParmBSC1 Water-Ethanol Electroneutral 200 CGCGAATTCGCG
NAFlex_v106Bt10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 TGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGATATCTT
NAFlex_v106Ct10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 GAGGATATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGT
NAFlex_v106R2t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106R3t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_DDD_GMX_CPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_GMX_GPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_Amber_CPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_Amber_GPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_v106t9 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 50 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_A2B_1 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_2 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_3 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_4 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_5 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG