Entry: NAFlex_56merL


Nucleic Acid Data:


SequenceCGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
Rev. SequenceGCGCGGCATGGGGCATTTTTTTGAGCGCGCGCCTATTTTTTCGGCTACTGCCGGCG
TypeDNA
SubTypeB
Chainsduplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-21
Simulated Time500 ns
Time Step10 ps
PartsDNA+ions
Temperature298K
WaterTIP3P
Additional SolventNo
Counter IonsK+Cl-
Ionic Concentration0.15M
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorP.D.
Chainsduplex
Comments-
CounterIonsK+Cl-
Formatmdcrd
FrameStep10 ps
Frames50000
IonicConcentration0.15M
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA+ions
RMSd_avg6.612
RMSd_stdev2.500
Rgyr_avg52.606
Rgyr_stdev1.125
SASA_avg19298.708
SASA_stdev279.995
SubTypeB
Temperature298K
Topologyf56merL_nowat.prmtop
Trajectoryf56merL_1-500.mdcrd
WaterTIP3P
_idNAFlex_56merL
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-21
descriptionDNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceGCGCGGCATGGGGCATTTTTTTGAGCGCGCGCCTATTTTTTCGGCTACTGCCGGCG
saltConcentration-
sequenceCGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
soluteAtoms3548
soluteCharge-110
soluteResidues112
solventAtoms-
solventResidues-
time500
totalAtoms3548
totalCharge-110
totalIons-
totalResidues112
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-