Entry: NAFlex_GC-rich_crowd_Na_500mM


Nucleic Acid Data:


SequenceCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
Rev. SequenceGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTG
TypeDNA
SubTypeB
ChainsMultiple duplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked TIP3P AddedSalt


Simulation Metadata
Force FieldparmBSC1
Simulation Date2021-Dec-02
Simulated Time5,000 ns
Time Step1000 ps
PartsDNA+ions
Temperature298K
WaterTIP3P
Additional SolventNo
Counter IonsNa+Cl-
Ionic Concentration0.5M
Additional IonsNa+
Additional MoleculesNo
Ions ParametersJoung&Cheatham
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNa+
AdditionalMoleculesNo
AdditionalSolventNo
AuthorF.B.
ChainsMultiple duplex
CommentsLysArg project
CounterIonsNa+Cl-
Formatmdcrd
FrameStep1000 ps
Frames5000
IonicConcentration0.5M
IonsParametersJoung&Cheatham
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA+ions
RMSd_avg100.808
RMSd_stdev9.219
Rgyr_avg86.048
Rgyr_stdev7.577
SASA_avg29686.461
SASA_stdev2147.055
SubTypeB
Temperature298K
Topologymdp_first_frame_nowat_tleap.top
Trajectorytraj_nowat.trj
WaterTIP3P
_idNAFlex_GC-rich_crowd_Na_500mM
datasetArray
date2021-Dec-02
descriptionDNA-B Duplex Naked TIP3P AddedSalt
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTG
saltConcentration-
sequenceCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
soluteAtoms11340
soluteCharge11340
soluteResidues360
solventAtoms-
solventResidues-
time5,000
totalAtoms11340
totalCharge11340
totalIons-
totalResidues360
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-