Entry: NAFlex_v106Ct10


Nucleic Acid Data:


SequenceGAGGATATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGT
Rev. SequenceACCTGCATCCTGAACCCATTGACTCCCAACCCCGTAATAGCGATAGGCCTTGATGTCGATAGCATTGCACGGGTCTTGTTCGATTAACTGCCGCAAAGATATCCTC
TypeDNA
SubTypeB
Chainscircular duplex
Pdb-
LigandsNo
KeywordsDNA-B Duplex Naked Parm99 TIP3P AddedSalt


Simulation Metadata
Force FieldparmBSC1
Simulation Date2015-Apr-27
Simulated Time100 ns
Time Step1ps
PartsDNA
Temperature300K
WaterTIP3P
Additional SolventNo
Counter IonsNa+Cl-
Ionic Concentration0.2M
Additional IonsNo
Additional MoleculesNo
Ions ParametersDang
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
Simulation Metadata (UMM)
AdditionalIonsNo
AdditionalMoleculesNo
AdditionalSolventNo
AuthorA.N.
Chainscircular duplex
Comments106bp 10 turns register C
CounterIonsNa+Cl-
Formatxtc
FrameStep1ps
Frames100000
IonicConcentration0.2M
IonsParametersDang
LigandsNo
NucTypeDNA
PDBNONE
PartsDNA
RMSd_avg11.509
RMSd_stdev1.915
Rgyr_avg55.655
Rgyr_stdev0.926
SASA_avg16776.539
SASA_stdev540.725
SubTypeB
Temperature300K
Topologyv106Ct10.gmx.gro
Trajectoryv106Ct10.all.lowres.xtc
WaterTIP3P
_idNAFlex_v106Ct10
authorsIvan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco
datasetArray
date2015-Apr-27
descriptionDNA-B Duplex Naked Parm99 TIP3P AddedSalt
forceFieldparmBSC1
ionsModel-
moleculeTypeDna
rev_sequenceACCTGCATCCTGAACCCATTGACTCCCAACCCCGTAATAGCGATAGGCCTTGATGTCGATAGCATTGCACGGGTCTTGTTCGATTAACTGCCGCAAAGATATCCTC
saltConcentration-
sequenceGAGGATATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGT
soluteAtoms6731
soluteCharge6731
soluteResidues212
solventAtoms-
solventResidues-
time100
totalAtoms6731
totalCharge6731
totalIons-
totalResidues212
Quality Control
RMSd-
Rgyr-
SASA-
RMSf-