Found 547 records matching search conditions

First shown

  Id. Type Subtype Time (ns) Sequence
NAFlex_apsAAT Dna triplex 240 AAAAAAAAAA | TTTTTTTTTT | AAAAAAAAAA | AAAAAAAAAA
NAFlex_psATT Dna triplex 440 AAAAAAAAAA | TTTTTTTTTT | TTTTTTTTTT | TTTTTTTTTT
NAFlex_ProtDNA_2kdz Prot-Dna duplex 2,000 AAGATAACGATATTTA
NAFlex_2lpw Dna single quadruplex 5,000 AAGGGTGGGTGTAAGTGTGGGTGGGT
NAFlex_ProtDNA_2or1 Dna duplex 2,000 AAGTACAAACTTTCTTGTAT
NAFlex_1hlv Dna duplex 1,000 AATCCCGTTTCCAACGAAGGC
NAFlex_ProtDNA_1hlv Prot-Dna duplex 2,000 AATCCCGTTTCCAACGAAGGC
NAFlex_1yo5 Dna duplex 1,000 ACACATCCTGCTA
NAFlex_ProtDNA_1yo5 Prot-Dna duplex 2,000 ACACATCCTGCTA
NAFlex_TF_6f57_14_dna_wholeA Dna duplex 200 AGAGCGCATG