Search Info:

Sequence: TCGT


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_ProtDNA_4oi7 4OI7 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CACGTTCGTAGCATCGTTGCAG
NAFlex_36merSPCE NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 300 CGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
NAFlex_36merTIP3P NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 300 CGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
NAFlex_v100t9 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGTTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT