ParmBSC1 forcefield Nucleotide MD Simulations Database

Found 547 records matching search conditions

First shown

Click on Id to open Simulation Metadata and Analyses

  Id. Type Subtype Time (ns) Sequence
NAFlex_RNA_miniABC_KCl_3 Rna ? GCAGAAACAGCUCUGCGC
NAFlex_TEST_HOSP Rna ? GCAGAAACAGCUCUGCGC
NAFlex_1dcw Dna Holliday Junction 1,000 CCGGTACCGG | CCGGTACCGG | CCGGTACCGG | CCGGTACCGG
NAFlex_AT-rich_crowd_Arg_500mM Dna Multiple duplex 5,000 TGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGT
NAFlex_AT-rich_crowd_Lys_500mM Dna Multiple duplex 5,000 TGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGT
NAFlex_AT-rich_crowd_Na_500mM Dna Multiple duplex 5,000 TGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGT
NAFlex_AT-rich_crowd_neut_500mM Dna Multiple duplex 5,000 TGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGTACAAAATATACATGTATATTTTGT
NAFlex_GC-rich_crowd_Arg_500mM Dna Multiple duplex 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_GC-rich_crowd_Lys_500mM Dna Multiple duplex 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_GC-rich_crowd_Na_500mM Dna Multiple duplex 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC