Entry: NAFlex_2jwv
MD Simulation >> (Click to expand/shrink)
| Simulation Metadata | |
|---|---|
| Force Field | parmBSC1 |
| Simulation Date | 1158710400000 |
| Simulated Time | 1,000 |
| Time Step | 200 ps |
| Parts | RNA |
| Temperature | 298K |
| Water | TIP3P |
| Additional Solvent | No |
| Counter Ions | Na+Cl- |
| Ionic Concentration | 0.15M |
| Additional Ions | No |
| Additional Molecules | No |
| Ions Parameters | Dang |
Unified Molecular Modeling (UMM) Metadata
(Click to see full UMM)
(Click to see full UMM)
| Simulation Metadata (UMM) | |
|---|---|
| AdditionalIons | No |
| AdditionalMolecules | No |
| AdditionalSolvent | No |
| Author | G.P. |
| Chains | duplex hairpin |
| Comments | RNA hairpin, loop description could be better |
| CounterIons | Na+Cl- |
| Format | xtc |
| FrameStep | 200 ps |
| Frames | 5000 |
| IonicConcentration | 0.15M |
| IonsParameters | Dang |
| Ligands | No |
| NucType | RNA |
| PDB | 2JWV |
| Parts | RNA |
| RMSd_avg | 3.054 |
| RMSd_stdev | 0.812 |
| Rgyr_avg | 0.000 |
| Rgyr_stdev | 0.000 |
| SASA_avg | 0.000 |
| SASA_stdev | 0.000 |
| SubType | A |
| Temperature | 298K |
| Topology | init_2jwv.pdb |
| Trajectory | 2jwv_bsc1_5000.xtc |
| Water | TIP3P |
| _id | NAFlex_2jwv |
| authors | Ivan Ivani, Pablo D. Dans, Agnès Noy, Alberto Pérez, Ignacio Faustino, Adam Hospital, Jürgen Walther, Pau Andrio, Ramon Goñi, Alexandra Balaceanu, Guillem Portella, Federica Battistini, Josep Lluís Gelpí, Carlos González, Michele Vendruscolo, Charles A. Laughton, Sarah A. Harris, David A. Case and Modesto Orozco |
| dataset | Array |
| date | 1158710400000 |
| description | RNA-A Single Stranded Hairpin-Loop Naked ParmBSC1 TIP3P AddedSalt |
| forceField | parmBSC1 |
| ionsModel | - |
| moleculeType | Rna |
| rev_sequence | - |
| saltConcentration | - |
| sequence | GAUACUUGAAACUGUAAGGUUGGCGUAUC |
| soluteAtoms | 929 |
| soluteCharge | 929 |
| soluteResidues | 29 |
| solventAtoms | - |
| solventResidues | - |
| time | 1,000 |
| totalAtoms | 929 |
| totalCharge | 929 |
| totalIons | - |
| totalResidues | 29 |
| Quality Control | |
|---|---|
| RMSd | 3.054 (0.812) Å  |
| Rgyr |  |
| SASA |  |
| RMSf |  |
