Search Info:

Sequence: ACGC


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_GC-rich_crowd_Lys_500mM NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P AddedSalt 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_GC-rich_crowd_Arg_500mM NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P AddedSalt 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_GC-rich_crowd_neut_500mM NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P AddedSalt 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_GC-rich_crowd_Na_500mM NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P AddedSalt 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_ProtDNA_4f6n 4F6N Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGTATAGACGCGGTGACAC
NAFlex_2mhi 2MHI Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral Telomerase 1,027 GGAAACGCCGCGGUCAGCUCGGCUGCUGCGAAGAGUUCGUCUCUGUUGUUUCC
NAFlex_lks1 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 GCCTATAAACGCCTATAA
NAFlex_lks4 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 GGCGCGCACCACGCGCGG
NAFlex_muAAAC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCACAAACAAACAAACGC
NAFlex_muGAAC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCACGAACGAACGAACGC
NAFlex_muTAAC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCACTAACTAACTAACGC
NAFlex_miniABC_K_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_K_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_Na_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_K_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_Na_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_NaK_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_Na_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_NaK_5 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCATTGGGGACACTACGC
NAFlex_miniABC_NaK_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTGGCATGAAGCGACGC
NAFlex_2l8q 2L8Q Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 CGCATGCTACGC
NAFlex_2m2c 2M2C Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 GCGCATGCTACGCG
NAFlex_TCGA NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGTCGACGCG
NAFlex_TCGAhmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGTXGACGCG
NAFlex_TCGAmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGTXGACGCG
NAFlex_FOXO3_crystal_rep0 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 500 GACTATGTAAACAACGC
NAFlex_GC-rich_Arg_25mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_GC-rich_Lys_25mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_GC-rich_Na_25mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_GC-rich_Na_500mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_GC-rich_Arg_500mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_GC-rich_Lys_500mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_GC-rich_Na_1500mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_GC-rich_Arg_1500mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_GC-rich_Lys_1500mM NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 400 GTCCACGCCC
NAFlex_rna4 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 201 GGCGCGCACCACGCGCGG
NAFlex_rna1 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 200 GCCUAUAAACGCCUAUAA
NAFlex_CG_OG1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTCXAACGCACGCXCGCGCTGTCCXCCGCGTTTCXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_OG2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACXGCTTAAACCXACGTACGCGCXGTCCCCCGCXTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5hmC1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXGAACGCACGXGCGCGCTGTCXGCCGCGTTTXGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5hmC2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXGGCTTAAACXGACGTACGCGXGGTCCCCCGXGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5mC1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXGAACGCACGXGCGCGCTGTCXGCCGCGTTTXGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5mC2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXGGCTTAAACXGACGTACGCGXGGTCCCCCGXGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_noalch1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTCGAACGCACGCGCGCGCTGTCCGCCGCGTTTCGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_noalch2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACGGCTTAAACCGACGTACGCGCGGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_DZ1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_PP1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXXAACGCACGXXCGCGCTGTCXXCCGCGTTTXXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_PP2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXXGCTTAAACXXACGTACGCGXXGTCCCCCGXXTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_SSB1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_SSB2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXTGCTTAAACXTACGTACGCGXTGTCCCCCGXTTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_TG1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_TT1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXXAACGCACGXXCGCGCTGTCXXCCGCGTTTXXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_TT2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXXGCTTAAACXXACGTACGCGXXGTCCCCCGXXTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_noalch1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_FOXA3_crystal_rep0 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep1 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep2 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep3 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep4 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_crystal_rep5 1VTN Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_mut_rep0 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep1 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep2 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep3 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep4 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_mut_rep5 Prot B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_mut_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_mut_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXO3_crystal_rep1 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep2 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep3 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep4 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_crystal_rep5 2UZK Dna B parmBSC1 SPCE DNA-B Duplex Protein-Nuc SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXO3_dna_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTATGTAAACAACGC
NAFlex_FOXA3_dna_rep3 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep4 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep0 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep1 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep2 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC
NAFlex_FOXA3_dna_rep5 Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 50 GACTAAGTCAACCACGC