Search Info:

Sequence: GCGA


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_D05M 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 3,000 CGCGAATTCGCG
NAFlex_DTipDang015M 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 2,000 CGCGAATTCGCG
NAFlex_BSC1-BSC0 1NAJ Dna B parmBSC0 TIP3P DNA-B Duplex Naked TIP3P Electroneutral ParmBSC0 1,500 CGCGAATTCGCG
NAFlex_BSC1-C36 1NAJ Dna B Charmm36 TIP3P DNA-B Duplex Naked Charmm36 TIP3P Electroneutral 1,500 CGCGAATTCGCGCGCGAATTCGCG
NAFlex_BSC1-Garcia 1NAJ Dna B ParmBSC0-CG TIP3P DNA-B Duplex Naked Cheng-Garcia TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL1 1NAJ Dna B ParmBSC0-OL1 TIP3P DNA-B Duplex Naked OL1 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL1-OL4 1NAJ Dna B ParmBSC0-OL1-OL4 TIP3P DNA-B Duplex Naked OL1+OL4 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_BSC1-OL4 1NAJ Dna B ParmBSC0-OL4 TIP3P DNA-B Duplex Naked OL4 TIP3P Electroneutral 1,500 CGCGAATTCGCG
NAFlex_DDD_II 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,200 CGCGAATTCGCG
NAFlex_2mhi 2MHI Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral Telomerase 1,027 GGAAACGCCGCGGUCAGCUCGGCUGCUGCGAAGAGUUCGUCUCUGUUGUUUCC
NAFlex_GAGA_RNA 1Q9A Rna A parmBSC0 TIP3P RNA-A Single Stranded Naked ParmBSC0 TIP3P Electroneutral Sarcin-Ricin Hairpin loop Flipout-bases 1,022 CGCGAGAGCG
NAFlex_1pqt 1PQT Dna B parmBSC1 TIP3P DNA-B Single Stranded Naked ParmBSC1 TIP3P AddedSalt Hairpin 1,000 GCGAAGC
NAFlex_AGCG NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCCGAGCGAGCGAGCGGC
NAFlex_GGGA NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCGAGGGAGGGAGGGAGC
NAFlex_DDD_II_1 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DDD_II_2 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DSpcCheatham 1BNA Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DSpcDang 1BNA Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 1,000 CGCGAATTCGCG
NAFlex_DTipCheatham 1BNA Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 CGCGAATTCGCG
NAFlex_muAGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGAAGGAAGGAAGGAGC
NAFlex_muCGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGACGGACGGACGGAGC
NAFlex_muGGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGAGGGAGGGAGGGAGC
NAFlex_muTCGA NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCGATCGATCGATCGAGC
NAFlex_muTGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGATGGATGGATGGAGC
NAFlex_miniABC_NaK_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_K_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_K_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGAACTCAAAGGTTGGC
NAFlex_miniABC_K_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_Na_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_Na_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGAACTCAAAGGTTGGC
NAFlex_miniABC_Na_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_NaK_12 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTGGCATGAAGCGACGC
NAFlex_miniABC_NaK_6 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGAACTCAAAGGTTGGC
NAFlex_DDD_800ns 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 800 CGCGAATTCGCG
NAFlex_56merTIP3P NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
NAFlex_ACGT NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGACGTCGCG
NAFlex_CTAG_12 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTACTAGCGAGGC
NAFlex_CTAG_16 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTCCTAGCGAGGC
NAFlex_CTAG_19 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGTCTGCTAGCGAGGC
NAFlex_colibactin1 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 400 CGCGAAAATTTTCGCG
NAFlex_36merSPCE NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 300 CGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
NAFlex_36merTIP3P NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 300 CGCGATTGCCTAACGAGTACTCGTTAGGCAATCGCG
NAFlex_56merSPCE NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 290 CGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
NAFlex_ACGThmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 250 CGCGAXGTCGCG
NAFlex_ACGTmet NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 250 CGCGAXGTCGCG
NAFlex_Naked_RNA_RNA NONE Rna A parmBSC1 SPCE RNA-A Duplex Naked SPC/E AddedSalt 250 CGCGAA
NAFlex_Naked_DNA_DNA NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked SPC/E AddedSalt 250 CGCGAA
NAFlex_Naked_DNA_RNA NONE Rna B parmBSC1 SPCE -B Duplex Naked SPC/E AddedSalt 250 CGCGAA
NAFlex_A-Ethanol 1BNA Dna A (in ethanol) parmBSC1 Wat-Ethanol DNA-A Duplex Naked ParmBSC1 Water-Ethanol Electroneutral 200 CGCGAATTCGCG
NAFlex_1d89 1D89 Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 200 CGCGAAAAAACG
NAFlex_DDD_GMX_CPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_GMX_GPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_Amber_CPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_DDD_Amber_GPU 1NAJ Dna B parmBSC1 TIP3P DNA-B Duplex Naked DDD ParmBSC1 TIP3P Electroneutral 100 CGCGAATTCGCG
NAFlex_A2B_1 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_2 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_3 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_4 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG
NAFlex_A2B_5 1BNA Dna B parmBSC1 TIP3P DNA-Mixed Duplex Naked ParmBSC1 TIP3P Electroneutral Transition 40 CGCGAATTCGCG