Search Info:

Sequence: CCGA


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_ProtDNA_1c7u 1C7U Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CTCGGCTATTAATAGCCGAG
NAFlex_AGCG NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCCGAGCGAGCGAGCGGC
NAFlex_miniABC_NaK_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_K_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGACCGAATGTAATTGC
NAFlex_miniABC_Na_7 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGACCGAATGTAATTGC
NAFlex_56merL NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_CTAG_1 NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 500 CGTCGGCTAGCCGAGC
NAFlex_56merB NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 440 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_56merA NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 360 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_56merSeq2 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P Electroneutral 300 CGTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGCG
NAFlex_CG_OG1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTCXAACGCACGCXCGCGCTGTCCXCCGCGTTTCXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_OG2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACXGCTTAAACCXACGTACGCGCXGTCCCCCGCXTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5hmC1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXGAACGCACGXGCGCGCTGTCXGCCGCGTTTXGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5hmC2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXGGCTTAAACXGACGTACGCGXGGTCCCCCGXGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5mC1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXGAACGCACGXGCGCGCTGTCXGCCGCGTTTXGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5mC2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXGGCTTAAACXGACGTACGCGXGGTCCCCCGXGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_noalch1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTCGAACGCACGCGCGCGCTGTCCGCCGCGTTTCGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_noalch2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACGGCTTAAACCGACGTACGCGCGGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_DZ1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_DZ2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXTGCTTAAACXTACGTAC
NAFlex_TT_PP1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXXAACGCACGXXCGCGCTGTCXXCCGCGTTTXXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_PP2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXXGCTTAAACXXACGTACGCGXXGTCCCCCGXXTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_SSB1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_SSB2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXTGCTTAAACXTACGTACGCGXTGTCCCCCGXTTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_TG1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_TT1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXXAACGCACGXXCGCGCTGTCXXCCGCGTTTXXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_TT2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXXGCTTAAACXXACGTACGCGXXGTCCCCCGXXTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_noalch1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_noalch2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCAXTGCTTAAACXTACGTAC