Search Info:

Sequence: GCGC


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_GC-rich_crowd_Lys_500mM NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P AddedSalt 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_GC-rich_crowd_Arg_500mM NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P AddedSalt 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_GC-rich_crowd_neut_500mM NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P AddedSalt 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_GC-rich_crowd_Na_500mM NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P AddedSalt 5,000 CACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGCGCACCGGGCGTGCACGCCCGGTGC
NAFlex_ProtDNA_1zgw 1ZGW Prot-Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 GCAAATTAAAGCGCAAGA
NAFlex_BSC1-C36 1NAJ Dna B Charmm36 TIP3P DNA-B Duplex Naked Charmm36 TIP3P Electroneutral 1,500 CGCGAATTCGCGCGCGAATTCGCG
NAFlex_437d 437D Rna A parmBSC0 TIP3P RNA-A Single Stranded Naked ParmBSC0 TIP3P Electroneutral Pseudoknot Flipout-bases Overhanging-bases Loops 1,015 GGCGCGGCACCGUCCGCGGAACAAACGG
NAFlex_2y95 2Y95 Rna A parmBSC1 TIP3P RNA-A Single-Stranded Naked ParmBSC1 TIP3P AddedSalt Hairpin-loop 1,000 GGCGCAUCGGCGCC
NAFlex_GGGC NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCGCGGGCGGGCGGGCGC
NAFlex_lks4 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 GGCGCGCACCACGCGCGG
NAFlex_1zgw 1ZGW Dna B parmBSC1 SPCE DNA-B Duplex ParmBSC1 SPC/E AddedSalt 1,000 GCAAATTAAAGCGCAAGA
NAFlex_muAGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCAGGCAGGCAGGCGC
NAFlex_muATGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCATGCATGCATGCGC
NAFlex_muCGCG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCCGCGCGCGCGCGCGGC
NAFlex_muCGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCCGGCCGGCCGGCGC
NAFlex_muGGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCGGGCGGGCGGGCGC
NAFlex_muTGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCTGGCTGGCTGGCGC
NAFlex_miniABC_K_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_K_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCAGGCGCAAGACTGAGC
NAFlex_miniABC_Na_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_Na_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCAGGCGCAAGACTGAGC
NAFlex_miniABC_NaK_3 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAGAAACAGCTCTGCGC
NAFlex_miniABC_NaK_4 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCAGGCGCAAGACTGAGC
NAFlex_Z-DNA-4M 1I0T Dna Z parmBSC1 TIP3P DNA-Z Duplex Naked ParmBSC1 TIP3P AddedSalt 946 CGCGCGCGCG
NAFlex_2hkb 2HKB Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 CTCGGCGCCATC
NAFlex_2m2c 2M2C Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 590 GCGCATGCTACGCG
NAFlex_56merL NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_CTAG_10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCGCGCTAGCGCGGC
NAFlex_CTAG_9 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGGCGCCTAGGCGCGC
NAFlex_56merB NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 440 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_PYR NONE Dna DNA unfolding parmBSC1 TIP3P DNA Duplex Naked ParmBSC1 TIP3P Electroneutral 400 GGCGCC
NAFlex_Z-DNA-0M 1I0T Dna Z parmBSC1 TIP3P DNA-Z Duplex Naked ParmBSC1 TIP3P Electroneutral 385 CGCGCGCGCG
NAFlex_56merA NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 360 CGCCGGCAGTAGCCGAAAAAATAGGCGCGCGCTCAAAAAAATGCCCCATGCCGCGC
NAFlex_56merSeq2 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P Electroneutral 300 CGTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGCG
NAFlex_ZDNA NONE Dna Z parmBSC1 TIP3P DNA-Z Duplex Naked ParmBSC1 TIP3P Electroneutral 240 CGCGCGCGCG
NAFlex_rna4 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 201 GGCGCGCACCACGCGCGG
NAFlex_CG_OG1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTCXAACGCACGCXCGCGCTGTCCXCCGCGTTTCXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_OG2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACXGCTTAAACCXACGTACGCGCXGTCCCCCGCXTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5hmC1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXGAACGCACGXGCGCGCTGTCXGCCGCGTTTXGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_5mC1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXGAACGCACGXGCGCGCTGTCXGCCGCGTTTXGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_noalch1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTCGAACGCACGCGCGCGCTGTCCGCCGCGTTTCGACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_CG_noalch2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACGGCTTAAACCGACGTACGCGCGGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_DZ1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_PP1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXXAACGCACGXXCGCGCTGTCXXCCGCGTTTXXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_SSB1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_TG1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_TT1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXXAACGCACGXXCGCGCTGTCXXCCGCGTTTXXACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TT_noalch1 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTXTAACGCACGXTCGCGCTGTCXTCCGCGTTTXTACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TF_6f57_14_dna_wholeA - Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 200 AGAGCGCATG
NAFlex_TF_6f57_14_dna_wholeB - Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 200 AGAGCGCATG
NAFlex_TF_6f57_16_dna_wholeA - Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 200 AGAGCGCATG
NAFlex_TF_6f57_16_dna_wholeB - Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 200 AGAGCGCATG
NAFlex_TF_6f57_14_wholeA - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 AGAGCGCATG
NAFlex_TF_6f57_14_wholeB - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 AGAGCGCATG
NAFlex_TF_6f57_16_wholeA - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 AGAGCGCATG
NAFlex_TF_6f57_16_wholeB - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 AGAGCGCATG