Search Info:

Sequence: GCGG


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_ProtDNA_4f6n 4F6N Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 2,000 CGTATAGACGCGGTGACAC
NAFlex_2mhi 2MHI Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral Telomerase 1,027 GGAAACGCCGCGGUCAGCUCGGCUGCUGCGAAGAGUUCGUCUCUGUUGUUUCC
NAFlex_437d 437D Rna A parmBSC0 TIP3P RNA-A Single Stranded Naked ParmBSC0 TIP3P Electroneutral Pseudoknot Flipout-bases Overhanging-bases Loops 1,015 GGCGCGGCACCGUCCGCGGAACAAACGG
NAFlex_AGCG NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCCGAGCGAGCGAGCGGC
NAFlex_GGGC NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCGCGGGCGGGCGGGCGC
NAFlex_GGGG NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E AddedSalt 1,000 GCGGGGGGGGGGGGGGGC
NAFlex_lks4 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 GGCGCGCACCACGCGCGG
NAFlex_muCGCG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCCGCGCGCGCGCGCGGC
NAFlex_muGGGC NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGCGGGCGGGCGGGCGC
NAFlex_muGGGG NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGGGGGGGGGGGGGGGC
NAFlex_miniABC_Na_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_K_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_NaK_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_miniABC_Na_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_NaK_10 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTACGCGGATCGAGAGC
NAFlex_miniABC_K_8 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCGGAGGGCCGGGTGGGC
NAFlex_CTAG_10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P AddedSalt 500 CGCGCGCTAGCGCGGC
NAFlex_56merSeq2 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P Electroneutral 300 CGTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGCG
NAFlex_rna4 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 201 GGCGCGCACCACGCGCGG
NAFlex_CG_noalch2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACGGCTTAAACCGACGTACGCGCGGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_TF_1hlv_18_dna_wholeA - Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 200 GCCTTCGTTGGATGCGGXATT
NAFlex_TF_1hlv_18_dna_wholeB - Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 200 GCCTTCGTTGGATGCGGXATT
NAFlex_TF_1le5_16_dna_wholeA - Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 200 AGCGGAAATTCCCG
NAFlex_TF_1le5_16_dna_wholeB - Dna B parmBSC1 TIP3P DNA-B Duplex Naked TIP3P Electroneutral 200 AGCGGAAATTCCCG
NAFlex_TF_1hlv_18_wholeA - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 GCCTTCGTTGGATGCGGXATT
NAFlex_TF_1hlv_18_wholeB - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 GCCTTCGTTGGATGCGGXATT
NAFlex_TF_1le5_16_wholeA - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 AGCGGAAATTCCCG
NAFlex_TF_1le5_16_wholeB - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 AGCGGAAATTCCCG
NAFlex_TF_1le5_17_wholeA - Prot B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 AGCGGAAATTCCCG
NAFlex_v106Bt10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 TGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGATATCTT
NAFlex_v106Ct10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 GAGGATATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGT
NAFlex_v106R2t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106R3t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106t9 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 50 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT