Search Info:

Sequence: ACGG


Retrieve MetaTrajectory

Click on Id to open Simulation Metadata and Analyses

Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
Id. PDB Type SubType ForceField Solvent Description Time (ns) Sequence
NAFlex_hybrid NONE Rna A parmBSC0 TIP3P Hybrid-A Duplex Naked ParmBSC0 TIP3P Electroneutral 1,037 CTACACGG
NAFlex_437d 437D Rna A parmBSC0 TIP3P RNA-A Single Stranded Naked ParmBSC0 TIP3P Electroneutral Pseudoknot Flipout-bases Overhanging-bases Loops 1,015 GGCGCGGCACCGUCCGCGGAACAAACGG
NAFlex_lks3 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 1,000 CACGGAACCGGTTCCGTG
NAFlex_muCGGA NONE Dna B parmBSC0 SPCE DNA-B Duplex Naked ParmBSC0 SPC/E AddedSalt 1,000 GCGACGGACGGACGGAGC
NAFlex_miniABC_NaK_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl/KCl 50%/50% 1,000 GCTTGTGACGGCTAGGGC
NAFlex_miniABC_K_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol KCl 1,000 GCTTGTGACGGCTAGGGC
NAFlex_miniABC_Na_13 NONE Dna B parmBSC1 SPC/E B-DNA Duplex Naked ParmBSC1 SPC/E 0.15 mol NaCl 1,000 GCTTGTGACGGCTAGGGC
NAFlex_56merTIP3P NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral 500 CGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
NAFlex_AAf NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ModifiedNucleotides ParmBSC1 TIP3P Electroneutral 500 CCATACAATACGG
NAFlex_GGf NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked ModifiedNucleotides ParmBSC1 TIP3P Electroneutral 500 CCATACGATACGG
NAFlex_56merSPCE NONE Dna B parmBSC1 SPCE DNA-B Duplex Naked ParmBSC1 SPC/E Electroneutral 290 CGCGATTGCCTAACGGACAGGCATAGACGTCTATGCCTGTCCGTTAGGCAATCGCG
NAFlex_rna3 NONE Rna A parmBSC0 TIP3P RNA-A Duplex Naked ParmBSC0 TIP3P Electroneutral 202 CACGGAACCGGUUCCGUC
NAFlex_1fzx 1FZX Dna B parmBSC1 TIP3P DNA-B Duplex Naked ParmBSC1 TIP3P Electroneutral A-track 200 GGCAAAAAACGG
NAFlex_CG_noalch2 - Dna B parmBSC1 TIP3P -B Duplex Naked TIP3P Electroneutral 200 XXXXXXXXGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACGGCTTAAACCGACGTACGCGCGGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC
NAFlex_v100t9 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGTTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106Bt10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 TGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGATATCTT
NAFlex_v106Ct10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 GAGGATATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGT
NAFlex_v106R2t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106R3t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106t10 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 100 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT
NAFlex_v106t9 NONE Dna B parmBSC1 TIP3P DNA-B Duplex Naked Parm99 TIP3P AddedSalt 50 ATCTTTGCGGCAGTTAATCGAACAAGACCCGTGCAATGCTATCGACATCAAGGCCTATCGCTATTACGGGGTTGGGAGTCAATGGGTTCAGGATGCAGGTGAGGAT