Project Output for sample MC DNA - Coarse Grain
In the ‘Summary’ section, you can download all the analysis results and the structure / trajectory in a compressed tar.gz file. Also, you can view the structure with DNA in relaxed state and / or the trajectory. Both of them are visualized in NGL viewer.
Selected Tool | MC DNA |
Resolution | Coarse Grain |
Operations | Create Structure, Create Trajectory |
Number of Structures | 100 |
Input sequence | GATTACATACATACAGATTACATACATACA |