Project Output for sample Circular MC DNA - Coarse Grain
In the ‘Summary’ section, you can download all the analysis results and the structure / trajectory in a compressed tar.gz file. Also, you can view the structure with DNA in relaxed state and / or the trajectory. Both of them are visualized in NGL viewer.
Selected Tool | Circular MC DNA |
Resolution | Coarse Grain |
Operations | Create Structure, Create Trajectory |
Delta linking number | -1 |
Iterations per structure | 25000000 |
Number of Structures | 10 |
Input sequence | TCTCTCTCTCTCTCTCTTAAAGGTATACAAGAAAGTTTGTTGGTCTTTTTACCTTCCCGTTTCGCTCCAAGTTAGTATAAAAAAGCTGAACGAG |